sensitive, acid. Depending on the disk type, a

sensitive, intermediate and resistant. According to standard method of NCCLS. The diameters of the zones of complete inhibition (as judged by the unaided eye) were measured, including the diameter of the disc. Zones are measured to the nearest whole millimeter. Results were interpreted according to the critical diameters in zone size interpretative charts.

            3.2.13.2 Phenotypic confirmatory testes for ESBL  production

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

Several manufacturers have developed ESBL detection tests based on the combination disk method. The principal of this method is to measure the inhibition zone around a disk of Cephalosporin and around a disk of the same Cephalosporin plus clavulanic acid. Depending on the disk type, a difference of >5 mm between the two diameters (i.e., corresponding to a two-fold dilution), or a zone expansion of 50% are considered as indicating ESBL  production (Carter et al., 2000; M’Zli et al., 2000). The test is easy to perform and its interpretation is straightforward. Sensitivity and specificity for this method were first reported to be 96% and 100%, respectively. (Linscott et al.2005).

The CLSI advocates use of Cephalosporin (30mcg) alone Cefotaxime (30mcg), Ceftazidime (30mcg), Cefepime (30mcg), Cefepirome (30mcg) and in combination with clavulanic acid (10mcg) for phenotypic confirmation of the presence of ESBLs in Klebsiella pneumonia and E. coli. A difference of >5 mm between the zone diameters of either of the Cephalosporin disks and their respective Cephalosporin/Clavulanic  disk was taken to be phenotypic confirmation of ESBL production (CLSI, 2011). It should be emphasized that both Cefotaxime and Ceftazidime with and without clavulanic acid should be used. One reason for this is that the use of Ceftazidime alone has resulted in the inability to detect CTX-M producing organisms.( Brenwald et al., 2003).

3.2.13.3 Implications of positive Phenotypic Confirmatory Tests

According to CLSI guidelines, isolates which had a positive Phenotypic Confirmatory test should be reported as resistant to all Cephalosporins (except the Cephamycins,  Cefoxitin and Cefotetan), regardless of the MIC of that particular Cephalosporin. Beta-lactam/Beta lactamase inhibitor combinations (e.g., Piperacillin-tazobactam, Amoxicillin-clavulanic acid and Ampicillin-sulbactam) are not affected by this rule and should be reported as obtained during routine susceptibility tests (Perez et al., 2007). The Phenotypic confirmatory test are highly sensitive and specific compared to genotypic confirmatory tests. However, there are a number of instances where the phenotypic confirmatory tests may be falsely positive or negative. K. pneumonia or E. coli isolates which lack ESBLs but which hyper produce SHV-1 may give false confirmatory tests.

3.2.13.4  Antibiotic and AMR correlation

The widely known fact that bacterial plasmids carrying antimicrobial resistance are often known to code for antibiotics resistance. In order to establish this fact, correlation between antibiotic and AMR in collected AMR strains were examined, resistance patterns towards 10 different antibiotics Ceftazidime (30mcg), cefotaxime (30mcg), Cefpodoxim (10mcg), Azithromycin (15mcg), Metronidazole (4mcg), (Meropenem (10mcg), Amikacin (30mcg), Ampicilin (10mcg), Ceftriaxone (30mcg), and Ciprofloxacin (5mScg).

The AMR profile of the Forty-eight wild E.coli & Forty-two K.pneumoniae strains determined qualitatively. FIG. 18 by the Disk Diffusion Method. The AMR phenotypes did not occur with equal frequency in all the strains. Among the Ninety selected strains which showed the greatest resistance to an antibiotic, most of them expressed multiple antibiotic resistance. Resistance to more than one antibiotic was found in almost all the strains.

The strains were tested for their resistance to the different antibiotics qualitatively by the disk diffusion method. All antibiotic disks were ready to use and obtained from Hi-Media (India).

          3.2.13.5 Detection of ESBL Production Test

ESBL & PMQR producing E. coli & K. pneumonia were detected by performing the phenotypic confirmatory test following CLSI guidelines, and using Ceftazidime (30mcg), cefotaxime (30mcg), Cefepime (30mcg), Cefepirome (30mcg), alone and combination with clavulanic acid (10mcg).

The antibiotic resistance patterns of the wild-type E.coli & K. pneumonia strains were determined for each test discs containing cephalosporin (30mcg) alone Cefotaxime (30mcg), Ceftazidime (30mcg), Cefepime (30mcg), Cefepirome (30mcg) and in combination with clavulanic acid (10mcg) were applied. The inhibition zone around the cephalosporin disc combined with clavulanic acid were compared with the zone around the disc with the cephalosporin alone.

Isolated which showed an enlargement of the zone of inhibition greater than 5 mm on the clavulanic acid side of the disk compared to the results seen on the side without clavulanic acid were confirmed as ESBL producers.

Analysis of Protein Profiles

3.2.13.6 Protein Isolation

·         1ml overnight culture was used to harvested cells by centrifugation for 30 seconds

·        Discarded the supernatant.

·        Added 500 µl 50mM Tris- HCl Buffer.

·        Centrifuged at 12000 for 30 seconds.

·         Discarded the supernatant.

·         Added 25 µl distilled water.

·        Vortexed .

·        Added 25 µl of SDS gel loading buffer.

·        Boiled the sample for 5 minutes.

Sodium dodecyl sulfate polyacrylamide Gel electrophoresis and protein visualization

·        Injected the Resolving Gel into the gap of the two glass plates ¾ th part.

·         After completing polymerization poured the stacking gel solution directly onto the surface of the polymerized resolving gel.

·         Inserted the comb into the stacking gel solution.

·         Removed the comb after stacking gel polymerization.

·         Poured the Tris- Glycine electrophoresis buffer into electrophoresis tank.

·         Loaded up to 15?l of each sample into the bottom of the wells.

·         Attached the electrophoresis apparatus to an electric power supply.

·         After running the gel removed the glass plates from the electrophoresis apparatus.

             3.2.13.7 Stain

·         Immersed the gel in staining solution and placed on a slowly rotating platform.

             Destain

·         Soaked the gel in destaining solution on a slowly rocking platform.

changed the solution three or four times

            3.2.14 Plasmid DNA Isolation

Isolation of plasmid DNA from E. coli & K. pneumonia is a common routine in research laboratories. This protocol often referred to as a plasmid “mini-prep” yields fairly clean DNA quickly and easily. Plasmid DNA isolation is more demanding than genomic DNA isolation because plasmid DNA must be separated from chromosomal DNA, whereas a genomic DNA isolation needs only to separate total DNA from RNA, Protein, Lipid. Etc. Plasmid DNA was isolated by Alkaline Lysis as described by Birnboin and Doly (1979).

          3.2.14.1 Alkaline Lysis Method for Plasmid DNA Procedure

                

1.     Fill a micro centrifuge tube with bacterial culture grown in LB. Spin tube in

micro centrifuge for 10 minutes, and make sure tubes are balanced in micro centrifuge. Dump supernatant and drain tube briefly on paper towel.

2.     Repeat step 1 in the same tube again with more bacterial culture, because of

Increasing starting volume of cells so more plasmid DNA could be isolated per prep.

3.     Add 0.2 ml ice-cold Solution 1 to cell pellet and resuspend cells as much as possible using disposable transfer pipette, keep in ice for 5 minute and then shift to room temperature for 10 minutes.

·         Solution 1 contains glucose, Tris and EDTA. Glucose is added to increase the osmotic pressure outside the cells. Tris is a buffering agent agent is used to maintain a constant pH (= 8.0). EDTA protects the DNA from degradative enzymes (called DNAses); EDTA binds divalent cations that are necessary for DNAse activity.

4. Add 0.4 ml Solution ??, cap tubes and invert five times gently. Let tubes sit at 

    room temperature for 5 minutes.

·         Solution ?? contains NAOH and SDS (a detergent). The alkaline mixtures rupture the cells and the detergent breaks apart the liquid membrane and solubilizes cellular proteins. NaOH also denatures the DNA into single strands.

5. Add 0.3 ml ice-cold solution ???, cap tubes and invert five times gently.   

    Incubate tubes on ice for 10 minutes.

·         Solution ??? contains a mixture of acetic acid and Potassium acetate. The acetic acid neutralizes the pH, allowing the DNA strands to renature. The potassium acetate also precipitates the SDS from solution, along with the cellular debris. The E. coli chromosomal DNA, a partially renatured tangle at this step, is also trapped in the precipitate. The plasmid DNA remains in solution.

6. Centrifuge the tubes for 10 minutes at 10000 rpm. Transfer supernatant to fresh

    micro centrifuge tube using clean disposable transfer pipette. Try to avoid      

    taking any white precipitate during the transfer. It is better to leave a little   

    supernatant behind to avoid accidentally taking the precipitate.

·         This fractionation step separates the Plasmid DNA from the cellular debris and chromosomal DNA in pellet.

                      7.  Fill centrifuge tube with isopropanol (450 µl). Keep tubes in refrigerator for 10

                           minutes.

·         Isopropanol effectively precipitates nucleic acids, but is much less effective with proteins. A quick precipitation can therefore purify DNA from protein contaminants.

                   8.  Centrifuge tubes for 15 minutes at 13000 rpm. A milky pellet would be at the

                        bottom of the tube. Pour off supernatant without dumping out the pellet. Drain

                        tube on paper towel.

·         This fractionation step further purifies the plasmid DNA from contaminants.

        9. Add 1 ml of ice-cold 70% ethanol. Cap tube and mix by inverting several

times. Then spin tubes for 20 minutes at 10000 rpm. Pour off supernatant (be careful not to dump out pellet) and drain tube on paper towel.

·         Ethanol helps to remove the remaining salts and SDS from the preparation.

                   10. Allow tube to dry for 30 minutes in incubator (37° C). Add 50 µl TE buffer to

  tube. DNA is ready for use and can be stored indefinitely in the freezer.

                   11. Finally presence of plasmid checked by 0.7% agarose gel.

3.2.14.2  Gel electrophoresis and DNA visualization

The genomic DNA and Plasmid DNA isolated from the different strains were visualized following electrophoresis on 1? agarose gels in 0.5XTBE Gel with ethidium bromide (1?g/ml) and the patterns were photographed.

3.2.14.3  Screening for presence of plasmid

Using the alkaline lysis method (Birnboim and Dolly, 1979) the selected E.coli & K.pneumoniae strains were screened for the presence of plasmid. Following plasmid isolation, all the selected strains showed the presence of at least one detectable plasmid when visualized on 1? agarose gel   .

3.2.15. Molecular identification of ESBL& PMQR genes in E. coli &

                             K. pneumonia by PCR

The PCR was developed by combining different Universal primer pairs for TEM, CTX-M, qnrC (Wang et al.(2009), qnrD (Cavaco et al .(2009), qnrS and aac(6′)-lb- cr (Chen et al. (2012) virulence genes. The first step of PCR for the detection of TEM, CTX-M, qnrS and aac(6′)-lb-cr and also reporter gene for molecular identification of ESBL & PMQR were used as published earlier with some modifications (Table 6). 

3.2.15.1  PCR set for ESBL & PMQR gene

The template DNA used for PCR amplification was Plasmid DNA isolated by the alkaline lysis method from the E.coli & K.pneumoniae wild type strains.

PCR amplification was performed in a 25µl of reaction mixture composed of (final concentrations) 1x of Taq DNA Polymerase buffer, 200 µM each Nucleotide, the Twelve primers at the concentrations in the table above, 1U Taq DNA Polymerase, 2 µl template DNA and water nuclease-free to 25 µl. The cycling conditions were 1 cycle for 5 minutes at 95° C; 30 cycles for 45 seconds at 95° C,  45 seconds 55° C and 45 seconds at 72° C; and a final extension step for 10 minutes at 72° C in a thermal cycler. After amplification, 10 µl of PCR mixture was visualized after electrophoresis on a 1% agarose gel in Tris-Acetate-EDTA buffer by staining with Ethidium Bromide also abbreviated (EtBr) which binds strongly to DNA by intercalating between the base and is fluorescent meaning that it absorbs invisible UV light & transmits energy as visible orange light. EtBr is also a very strong mutagen. The purpose of gel might be to look at DNA to quantify it or to isolate a particular band. Only the presence of the correctly sized gene PCR product(s) was interpreted as a positive result. The sequences of the Primers and the expected amplicons sizes are shown in Table 6.     

Target gene

Oligonucleotide (5′ to 3′)

Amplicon size (bp)

Tm C°

TEM gene

F, TCCTGTTTTTGCTCACCCAG
R, CCTATCTCAGCGATCTGTCTA

780

58

CTX-M gene

F, ATGTGCAGYACCAGTAARGT
R, GCTGCCGGTYTTATCMCC

530

55

qnrC gene

F, GGGTTGTACATTTATTGAATC
R, TCCACTTTACGAGGTTCT

       447

50

qnrD gene

F, CGAGATCAATTTACGGGGAATA
R, AACAAGCTGAAGCGCCTG

       582

57

qnrS

F, GACGTGCTAACTTGCGTGAT
R, GATCTAAACCGTCGAGTTCG

456

50

aac(6′)-Ib

F, TTGCGATGCTCTATGAGTGGCTA
R, CTCGAATGCCTGGCGTGTTT

482

52

 

  Table 6:  Sequences of primers and their melting temperature and predicted amplicons  

                 size used for detection of ESBL & PMQR genes.

PCR amplification of TEM Gene

After an initial hot start at 95°c for 5 minutes, amplification was carried out for 30 cycles with each cycle consisting of a denaturation step (94°C, 30 seconds), an annealing step (64°C, 30 seconds) and an extension step (72°C, 45 seconds). To enable the reaction to go to completion, after the last cycle, the extension was continued for a further 10 minutes.

PCR amplification of CTX-M Gene

After an initial hot start at 95°c for 5 minutes, amplification was carried out for 30 cycles with each cycle consisting of a denaturation step (94°C, 30 seconds), an annealing step (65°C, 40 seconds) and an extension step (72°C, 45 seconds).

To enable the reaction to go to completion, after the last cycle, the extension was continued for a further 10 minutes.

PCR amplification of qnrC Gene

After an initial hot start at 95°c for 5 minutes, amplification was carried out for 30 cycles with each cycle consisting of a denaturation step (94°C, 30 seconds), an annealing step (50°C, 30 seconds) and an extension step (72°C, 45 seconds).

To enable the reaction to go to completion, after the last cycle, the extension was continued for a further 10 minutes.

PCR amplification of qnrD Gene

After an initial hot start at 95°c for 5 minutes, amplification was carried out for 30 cycles with each cycle consisting of a denaturation step (94°C, 30 seconds), an annealing step (57°C, 30 seconds) and an extension step (72°C, 45 seconds).

To enable the reaction to go to completion, after the last cycle, the extension was continued for a further 10 minutes.

PCR amplification of qnrS Gene

After an initial hot start at 95°c for 5 minutes, amplification was carried out for 30 cycles with each cycle consisting of a denaturation step (94°C, 30 seconds), an annealing step (55°C, 30 seconds) and an extension step (72°C, 45 seconds).

To enable the reaction to go to completion, after the last cycle, the extension was continued for a further 10 minutes.

PCR amplification of aac(6′)-lb Gene

After an initial hot start at 95°c for 5 minutes, amplification was carried out for 30 cycles with each cycle consisting of a denaturation step (94°C, 30 seconds), an annealing step (60°C, 30 seconds) and an extension step (72°C, 45 seconds).

To enable the reaction to go to completion, after the last cycle, the extension was continued for a further 10 minutes.

3.2.15.2 Visualization of PCR products

An aliquot ( 5µl ) of each amplification reaction mixture was electrophoresed on .5x TBE and 1? agarose gels with ethidium bromide (1?g/ml) for TEM, CTX-M, qnrC, qnrD,

qnrS and for aac(6′)-lb gene respectively.

3.2.15.3 Analysis of ESBL & PMQR genes

Characterization of the DNA sequences was carried out by BLAST analysis as described in the earlier section.